Informace - DNA

Původ na základě kauzality?
Autor: Thel Thomas Akira
17.4. 2016


[Ilustrační foto, zdroj: http://www.redorbit.com/media/uploads/2012/11/DNA.jpg]

   Mnoho lidí z řad odborné veřejnosti se dnes domnívá, že informace obsažená v DNA je výsledkem čistě fyzikálně-chemických zákonů, neřízených sil a procesů, kde mechanismus variability, přírodního výběru (selekce) a mutace, zpracovávají, dokonce vytváří (!) genetický kód do smysluplné podoby významu a funkce.

Tento naturalistický koncept, bych chtěl spolu s vámi podrobit hlubší reflexi. Nakolik je tato hojně rozšířená teze udržitelná? Je z principu možné něco takového obhajovat z pozice metodologického naturalismu? Jaké důsledky vyvstávají přijetím těchto závěrů v dosavadním paradigmatu?

___________________________________________________
Upozornění: Vzhledem ke stručnosti obsahu článku se zde budou objevovat termíny, které svým obsahem nemusí být všem čtenářům zřejmé.

   Úvod

   Počátkem 40. let 20. století začali američtí vědci Edward Tatum a George Beadle tušit, že má informace v DNA ve formě genetického kódu souvislost mezi funkcí a tvorbou enzymů.[1] Za necelých 12 let vědci Watson & Crick rozluštili a popsali strukturu DNA, včetně úlohy jejího informačního obsahu.[2]

   Dnes se ví, že informační hustota genomu je natolik vysoká, že jedna čajová lžička DNA by obsahovala údaje o 350x větším počtu lidí, než je současný počet obyvatel na naší planetě.[3] Učebnice „Molecular Biology of the Cell“ uvádí [4], že je tato informace stočená do buněčného jádra, a to takovým způsobem, jako kdybyste stočili 40 km tenkého vlákna do tenisového míčku, přičemž každá část by byla velice snadno přístupná k opravám a k replikaci. To není tak neúsporné řešení, pokud se DNA během průměrné délky lidského života s pozoruhodnou přesností zkopíruje asi 1016krát. [5] Vezmeme-li v úvahu, že kdyby se buňkám (např. bakteriím E. coli) dostalo neomezeného přísunu živin, stejně tak by nebyly ničím životně ohroženy, pak by za pouhé 2 dny byly 2 500x těžší, než je naše Země,[6] což je poměrně děsivá představa. Naštěstí je příroda stabilizovaná a precizně vyladěná tak, že nedochází k extrémním populačním výkyvům.

   DNA je nositelkou neobyčejně složitých informací. „Forma zápisu genetických informací byla odhalena u tzv. strukturálních genů.* Tyto geny jsou nositelem informace pro počet a pořadí aminokyselin v určitém polypeptidickém řetězci...“ [7] Podle novým zjištění projektu ENCODE, DNA ve skutečnosti užívá 2 úrovně programovacího jazyka! [8]

_______________________________________________________

   * Pozn.: pouze 1,5 – 2 % DNA lidského genomu se bezprostředně podílí na expresi strukturálních genů (viz ilustrace). Zbylou většinu tvoří sekvence – instrukce, řídící metabolické pochody, biochemické reakce, transport látek, signalizační kaskády, transkripci, uskladnění energie za pomocí ATP, opravné mechanismy atd. atd. To vše ve vhodný okamžik, ve správném pořadí a na správném místě.

   Popis: vysoce složité trojrozměrné bílkovinné struktury motoru bakteriálního bičíku, vzniklé prostřednictvím genové exprese a prostorových (matematických) algoritmů.


    Zdroj ilustrace: http://jb.asm.org/content/191/16/5026/F4.large.jpg]


___________________________________________________

   [Pozn.: Na levém sloupci ilustrace (A, B, C a D) jsou představeny díly elektromotoru vyrobené člověkem v současnosti. Na druhé straně ilustrace jsou organické supramolekulární části motoru bakteriálního bičíku na bázi protonů. Hnací hřídel spolu s hybnou sílou vodíkových iontů mu dodávají rychlost až 100 000 otáček za minutu [9], přitom mu stačí přibližně čtvrtina otáčky k zastavení, aby mohl opět točit 100 000 otáček na druhou stranu. [10] Prof. Haward Berg z Harvardské univerzity ho označil za nejvýkonnější stroj v celém známém vesmíru. [11] Pro představu: bakterie E. coli se 6 elektromotory o otáčkách 6 000/min se v našich poměrech pohybuje ve vodě rychlostí cca 400 km/h. [12] Tento charakteristický znak pohybové soustavy jednobuněčných organismů (prokaryot) zde přebývá od raného období „vývoje“ života. Organické komponenty svými specifickými rysy i účelem proto nápadně připomínají konstrukční prvky.]

   Položme si základní otázku: Jaký je původ této vysoce složité informace? Lze původ informačního obsahu vyvozovat ze samotného materiálního nosiče (DNA), a hledat její sémantický aspekt ve vlastnostech hmoty, jež je uspořádána fyzikálně-chemickými zákony?

   Veškerý softwarový svět užívá klasickou dvojkovou soustavu – binární kód, díky němuž vyjadřujeme širokou škálu kombinací a jsme schopni jakoukoliv informaci, jakékoliv sdělení vyjádřit pouze na základě jedniček a nul.

010100101011010110010101110101010010001011011100010101000
111001010101100100010110111000101010101011010010101101011
00101010101001000…
[Ilustrační příklad sady znaků binární soustavy]

   DNA užívá nikoliv binární, ale kvartérní soustavu. Sekvence nukleotidů (nukleových bází): adeninu (A) - guaginu (G) (tzv. puriny), a thyminu (T) – cytosinu (C) (tzv. pyrimidiny), tvoří základ genetické informace. „Na každé nukleotidové pozici se nachází jedna ze čtyř bází (A, C, T a G), což znamená, že sekvence o délce n může nabývat 4n stavů.“ [13]

ATCCTAACTAGCAATACCCAATACCAGGAGCATACCAATAGACTAGCATACCAACTAG
CATACCACCCAGGACTAGCAATCGCAGTCCAATACCAAATAGACTAGCATACCAAAG…

   [Ilustrační příklad kvartérní soustavy sady znaků DNA]

   Tímto genetický kód ze své podstaty disponuje daleko větším a nepředstavitelně obrovským množstvím kombinací. Máme-li např. nejmenší genom organismu s počtem 159 662 bází (Carsonella Ruddii, pozn.: jeden z nejmenších genomů organismů, jaký kdy byl objeven [14]), pak sada kombinací nabývá 4159 662 znaků!!! (Počet všech elementárních částic v celém známém vesmíru se odhaduje asi na 1080. [15])

Nejen, že se jedná o absurdní číslo, se kterým neoperuje ani teorie superstrun, nýbrž dalece přesahuje hranice jakékoliv myslitelné představy. Co teprve genom běžných eukaryotních organismů nebo savců jako je člověk (3,2 miliardy bází)? [16]

   Máme tedy prakticky nekonečné množství sady znaků. Co to vlastně znamená? Písmena A-G a T-C sice utvářejí páry v dvoušroubovici (di-helixu) DNA, prostřednictvím vodíkových můstků, ale uspořádanost mezi jednotlivými „písmeny“ na jednom ze dvou vláken (helixu), jež přesně určují instrukce pro stavbu biologických makromolekul, složité terciální bílkovinné struktury nebo prostorové matematické algoritmy, není dána na základě samotných vlastností bází*, protože počet nahodilých uspořádaných kombinací n-stavů bází je – jak jsme si ukázali – prakticky „nekonečný“. A jen malá část sady znaků dává účel a smysl.

   Jiný příklad.: Představte si obyčejnou sklenici vody a kostku cukru, která se v ní následně rozpustí.
Otázka: Jak lze odvodit z rozptýlených molekul cukru ve vodě jejich původní formu (tj. formu kostky), před vhozením do sklenice?

____________________________________________________

*pozn.: mezi jednotlivými bázemi totiž působí např. slabé Van der Waalsovy síly

   Věda může popisovat, jak probíhá difúze mezi molekulami vody a cukru (H2O a C12H22O11), může popisovat složení vody a cukru, je schopna určit optickou aktivitu a izomerii obsažených organických látek, je schopna popsat chemickou a fyzikální strukturu sklenice, ve které se nachází voda s cukrem atd., ale otázka typu: Jak lze z rozptýlených molekul cukru ve vodě odvodit jejich původní formu před vhozením do sklenice? je otázka zcela mimo rámec operační vědy, inklinující spíše k otázkám filosofie.

   Na základě fyzikálně-chemických vlastností cukru, který se rozpustil ve vodě, nelze a není možné odvozovat jeho původní tvar (kostku), protože ten může nabývat prakticky „nekonečných“ množství podob (řešení).

   Jiný příklad: Když se podíváme na stránku tištěného textu knihy. Vidíme, že text dává smysl. Každé jednotlivé písmeno (znakové abecedy, ať již české nebo jakékoliv jiné) je uspořádáno tak, že dává význam jednotlivým celkům, jako jsou slova, věty, odstavce, stránky, popř. celé kapitoly. Evolucionista Dr. Ridley zde shledává úzkou analogickou souvislost mezi nosičem informací DNA a tištěným textem:

   „Myšlenka o genomu jako knize není, v pravém slova smyslu, ani přirovnáním. Je to doslovná pravda. Kniha je kusem digitální informace… Stejně tak genom.“ – [17]

   Otázka: Je determinován sémantický aspekt informace v podobě písmen a celých vět vazebnými interakcemi inkoustu a papíru?

   Ještě jinak: Čím je určen smysl obsahu textu, který právě nyní čtete? Z hardwarového nosiče? Ze softwarového vybavení PC platformy? Vždyť to jsou jen data! Sémantická informace se z nich stává až po předešlém přiřazení významu a účelu funkce. Obyčejná věta: „Dobrý den!“ může být klidně stanovena kódující binární sadou znaků: 0100101011101, nebo: 011101111111, nebo: 000000001111, nebo: 1111111110000 ... jakoukoliv kombinací. Možností schopnosti vyjádření je nekonečně mnoho. Na čem tedy závisí jejich význam a jejich účel??

   Na dohodě! V prve řadě. Jenže dohoda je ze své podstaty záležitost čistě kreační, inteligentní, nemateriální, chcete-li duchovní. Materiál, nebo-li nosič je až sekundární složkou, stopou, odkazem této inteligentní, bezrozměrné veličiny.

   Ve chvíli, kdy v podobě libovolné sady kódu stanovíme určitý univerzální komunikační jazyk, pak jím prostřednictvím materiálního nosiče můžeme samozřejmě vyjádřit ohromné množství sdílené informace, ale to také znamená, že z nekonečně možných kombinací jsme si vybrali jen úzký prostor, poskytující význam a smysl. Stojíme tak na nezměrné, nepředstavitelně hluboké propasti bezvýznamných na jedné straně, a smysluplných forem znaků na straně druhé.

   Uvedená otázka proto nemůže být nikdy z principu kladně zodpovězena. Neboť z matematického hlediska existuje nekonečně mnoho řešení, které UMOŽŇUJÍ* množství kombinací způsobu vazebné interakce inkoustu a papíru.

   Informace v DNA představuje tentýž matematický problém, pouze malá část kombinací nukleotidů umožňuje správné využití proteinů i aminokyselin do kompletní funkční podoby fenotypu. Na druhé straně existuje obrovské, daleko vyšší množství kombinací, které nic smysluplného neposkytují (nekódují), nýbrž představují pouhý „informační šum“. Složitost astronomických čísel je tak zřejmá u bílkovin „ve kterých se pravidelně vyskytuje cca 20 aminokyselin, přičemž za vzniku dipeptidu mohou zreagovat libovolné dvě aminokyseliny. Pokud tedy průměrná bílkovina obsahuje asi 100 aminokyselinových zbytků, může vzniknout až 20100 (tj. 1,2 . 10130) jedinečných polypeptidů dané délky. Příroda však vytváří jen nepatrnou část z celého možného množství bílkovin.“ [18]

   Jestliže vědci popisují živou soustavu, jsou schopni určit, jaká je její energetická soustava, z jakých druhů aminokyselin je vytvořena, jaké biochemické reakce probíhají v jejím metabolismu, jaká je její fyziologie, kolik zpracuje informací atd., ale ve chvíli, kdy vyvstane otázka:

   Jak lze odvodit původ informace DNA (sémantický aspekt informace) na základě samotných základních stavebních organických jednotek (tj. nosiče: deoxyribózy, cukru, nukleové báze a fosfátové skupiny), než se objevil život v podobě, jakou známe nyní? Je otázka dílem z oblasti filosofie - metafyziky a dílem z oblasti biologie - bioinformatiky. A tak „mezi hmotným nosičem a genetickým kódem není žádná příčinná souvislost, jedno není příčinou druhého.“ [19]

    Závěr

   „Nyní by mělo být jasné, že informace, jakožto fundamentální entita, nemůže být záležitostí vlastností hmoty, a její původ nemůže být vysvětlován z hlediska materiálních procesů.“ - [20]

   Prof. Dr. Werner Gitt - informatik

______________________________________________________

* Pozn.: Fyzikálně-chemické vlastnosti umožňují vazebnou interakci inkoustu s papírem, ale v zásadě neurčují/nespecifikují podobu smyslu textu, možností je nespočet (umožnit a zapříčinit není jedno a totéž!). Jestliže prohlásíme, že smysl textu je výsledkem toliko chemické vazby, interakce inkoustu a papíru, pak se blížíme nalezení podstaty problému, odpovídajícím způsobem asi stejně jako výrok: „Hora Mount Everest se nachází někde v části vesmíru.“ Z téhož důvodu abstrakce nelze přistupovat k informaci, zaznamenané v DNA.

Příloha – nárůst informační komplexity DNA
fundamentální úskalí evoluční teorie?
__________________________________________________

   Začněme hned hlavní otázkou:

   Jak si evolucionisté představují postupný kumulativní nárůst informační komplexity, tj. bohatosti genofondu prvotních organismů do taxonomicky vyšší kategorie živočichů a rostlin v pozorované současné diverzitě?

   Tento výchozí předpoklad neodarwinismu - zdá se - měl být evolučními vědci zodpovězen od samotného začátku objevení deoxyribonukleové kyseliny (DNA), co by základu života a nositelky veškeré dědičné informace. Existují 3 navrhované modely neodarwinismu [21] :

      1. V sekvenci nukleotidů může být jedna báze nahrazena jinou.
      2. Sekvence bází DNA je zduplikována.
      3. Ve zduplikované sekvenci došlo ke zlepšující změně, z jedné           biologické funkce (fitness) organismu k druhé.

   Příklad: Vezměme si zmíněný nejjednodušší známý organismus (pozn.: „nejjednodušší“, co se týká množství celkového souboru genetické informace) - Carsonella Ruddii o řadové délce cca 159 662 párů bází (bp).[22] Pro naši představu je to asi 88 stránek formátu A4, popsaného sadou znaků genetické informace. Tyto geny postrádají patřičné funkce pro základní biologické buněčné procesy (replikace, transkripce, syntéza některých proteinů a bílkovin). Samotný život tohoto drobného organismu je udržován endosymbiózou, v hmyzu mery - (Pachypsylla venusta).[23]

   Pokud by trend kvantitativního snižování genetické informace měl pokračovat, zřejmě bychom se dostali k jednoduché formě genomů, podobné u virů. Ale má to háček, jak víme, viry nejenže se liší genetickou stavbou (uracil nahrazuje thymin), jsou především jakkoliv neschopny nezávisle na hostiteli vlastní replikace i reprodukce. Limit soběstačnosti je proto ohraničen počtem genů schopných vlastní, nezávislou životaschopností a reprodukcí organismu. Bude-li někdo prohlašovat, že jeden z prvotních jednoduchých organismů po vzniku života na Zemi obsahoval sadu genů pro autoreplikaci nebo reprodukci, měl by pochopitelně doložit, kolika nezbytně nutnými geny je takový biologický cyklus realizován. Pokud vůbec bude schopen předložit nějaké, pozorováním/experimenty ověřitelné číslo, evoluční „mystery of life“ začne být teprve zajímavá:

   Ponořme se do říše ničím neověřených spekulací a vyslovme tezi, že velmi jednoduchý, primitivní, soběstačný*, reprodukční organizmus obsahoval min. 100 genů, přičemž průměrný gen by obsahoval asi 900-1 000 nukleových bází. Pro představu: Je to asi 50 stran nahuštěného textu v podobě sady znaků genetické informace, ve formátu A4, viz následující ilustrace:

AGA/GCA/ATC/CTA/ATA/GCA/ATA/CCA/ATA/CCC/AAT/AGA/CTA/GAG/GAA/CTA/GCA/TAC/CAA/TAG/ACT/AGC/ATA/CCA/ACT/AGA/CTA/GCA/AGC/ATA/CCA/CCC/ACT/TAC/CAA/TAG/ACT/AGC/ATA/CCA/GAG/ACT/ AGC/ATA/CCA/ATC/CTG/AAT/ AAT/ CTGAGC/GGG/ACT/AGC/ATA/CCA/ATC/CTG/AGC/AGT/CCA/ACT/GCA/ATA/CCA/ATA/CCC/CCC/ACT/AGC/GGG/ACT/ACT/AGC/ATA/CCA/ATC/CTG/AAT/AGA/CTA/GAG/GAA/CTA/GCA/TAC/CAA/TAG/ACT/AGC/ATA/CCA/ACT/AGA/CTA/ATC/CTA/ACTA/GCA/ATA/CCA/ATA/CCC/AAT/AGA/CTA/GAG/GAA/CTA/GCA/TGC/CAA/TAG/ACT/AGG/ATA/CCA/ACT/AGA/CTA/AGC/GGG/ACT/AGC/ATA/CCA/ATC/CTA/ACTA/GCA/ATA/CCA/AAA/CCC/CCA/ACT/AGA/CTA/GAA/CTA/GCA/TAC/CAA/TAG/ACT/AGC/ATA/CCA/ACT/AGA/CTA/GCA/AGC/ATA/CCA/CCC/ACT/AGC/GGG/ACT/AGC/ATA/CCA/AGC/GGG/ACT/AGC/ATA/CCA/ATC/CTG/AGG/ACTA/GCA/ATA/CCA/ATA/CCC//CTA/GCA/TAC/CAA/TAG/ATA/CCA/ACT/AGA/CTA/GCA/GGG/ACT/AGC/ATA/CCA/ATC/CTG/AGC/AGT/CCA/ACT/GCA/ATA/CCA/ATA/CCC/CCC/ACT/AGC/GGG/ACT/ACT/AGC/ATA/CCC/AAT/AGA/CTA/CTA/AGC/GGG/ACT/AGC/ATA/ACT/AGA/CTA/GCA/GGG/CCA//ATA/CCA/CCC/ACT/AGC/GGG/ACT/AGC/ATA/CCA/ATC/CTG/AGC/AGT/CCA/ACT/GCA/ATA/CCA/ATA/CCC/CCC/ACT/AGC/GGG/ACT/GCA/ATA/CTA/GAG/ACT/AGC/
   [Ilustrační příklad jednoho genu. Nyní si to vynásobte 100x]

informace_-_dna_4-ilustracni_obrazek_tripletu_0.jpg

Každý z těchto kodonů (tripletů), kóduje pro organismus složité, životně důležité stavební aminokyseliny a proteiny. Pojďme postupovat dále:

    1. V sekvenci nukleotidů je např. jedna báze nahrazena jinou.

Při adici nebo deleci páru bází budou mít všechny následující triplety změněný smysl:

AGA/GCA/ATC/CTA/ATA/GCA/ATA/CCA/ATA/CCC/AAT/AGA/CTA/GAG/GAA/CTA/GCA/TAC/CAA/TAG/ACT/AGC/ATA/CCA/ACT/AGA/CTA/GCA/AGC/ATA/CCA/CCC/ACT/AGC/GGG/ACT...
   
___________________________________________________

(pozn.: sekvence tripletů před adicí)

Po adici (např. guaginu-G ) v první pozici:

GAG/AGC/AAT/CCT/AAT/AGC/AAT/ACC/AAT/ACC/CAA/TAG/ACT/AGA/GGA/ACT/AGC/ATA/CCA/ATA/GAC/TAG/CAT/ACC/AAC/TAG/ACT/AGC/AAG/CAT/ACC/ACC/CAC/TAG/CGG/GAC/...
____________________________________________________

* Pozn.: Soběstačný organismus by měl obsahovat daleko více genů, ale na druhou stranu evoluční teorie vyžaduje jednodušší formu.

   Všimněte si, že se posune čtecí rámec, proto se také logicky začnou sestavovat úplně jiné druhy aminokyselin. To znamená, že výsledný polypeptidický řetězec, kódován úsekem cistronu (tj. úseku sekvencí tripletů, kódujících aminokyseliny do proteinů) je úplně změněn. Co se stane, až se takový polypeptid v endoplasmatickém retikulu (chaperony) začne prostorově skládat, prostřednictvím speciálních instrukčních algoritmů do základních forem proteinů? Nebo, co by se stalo, kdyby se změnily samotné algoritmy? Je pak vůbec možné hovořit o výstavbě vysoce složitých, kvartérních a terciálních bílkovinných struktur? Nemluvě o tom, že DNA užívá 2 úrovní programovacího jazyka [8], nikoliv pouhou expresi genů pro fyziologickou výstavbu těla organismu. A tak závažnost situace můžeme shrnout takto:

   „Je zřejmé, že i při normální kombinaci dalších tripletů bude podstatně změněn celý smysl informace a při postižení většího úseku informace (pokud polypeptid vůbec vznikne), bude tato informace zcela odlišných vlastností. Tyto "molekulární" změny podmiňují mutace, které mají za následek neaktivní enzym, chybění enzymu, polypeptidu apod." - [24]

   V našem případě se jednalo o mutaci typu frame-shift. Pokud organismus přežije, nebo dojde ke změně sekvencí DNA (např. kódující složité metabolické pochody, umožňující trávit místo cukru citrát, viz Lenskiho experiment), lze hovořit o neuvěřitelném štěstí, ohraničeném výsledkem adaptačních mechanismů a sofistikovaného vybavení JIŽ EXISTUJÍCÍHO(!) genofondu organismu. Co se ale stane, pokud budou následovat další kroky nahodilých mutačních změn v DNA? Opět se změní celý smysl a je jisté, že organismus zahyne.

   Evoluční teorie ovšem předpokládá, že takových*, po sobě jdoucích, životaschopných kroků muselo být nespočet. Obdobně postuluje, že se všechny tyto genetické znaky rozšíří v populaci, a přeživší potomstvo nebude nijak sterilní. Taktéž postuluje, že selekční tlak na organismus probíhá kontinuálně. Ale poněvadž je v proměnlivém tlaku přirozeného prostředí, z praktického hlediska je něco takového vyloučeno, organismus po změně selekčních tlaků inklinuje do zpětné (původní) formy fitness funkce, (viz Flégrova „plasticita“ zamrzlé evoluce).
________________________________________________

*Pozn.: Pokud bychom zvažovali jinou formu evolučních mechanismů, např. „substituci“ sekvencí, problém by se nijak nezmenšil. Např. na šesté pozici beta-řetězci genu pro hemoglobin je zaměněn Valin místo kys. glutamové, což způsobuje srpkovitý tvar červených krvinek (viz srpkovitá anémie). Jedinci jsou sice odolnější vůči malárii, avšak za cenu nízkého průměrného věku dožití, nedostatečného okysličení organismu, nesprávné funkce oběhového systému atd. atd.). Pokud by k tomuto hnacímu mechanismu mělo nadále docházet, lze s největší pravděpodobností konstatovat, že dopady na zasaženou populaci budou nepříznivé, karcinogenní až letální.

    2. Sekvence bází DNA je zduplikována.

   Bezpochyby kvantitativně, již nikoliv kvalitativně. Gen zase vzniká z genu (J. Flégr - Evoluční Biologie, s. 201, v nových 203). Pokud by došlo ke zduplikování určitých sekvencí bází v DNA, znamenalo by to, že nadbytečné kopie začnou nadbytečně produkovat bílkoviny, čímž zákonitě dojde k narušení správné hladiny rovnováhy koncentrace bílkovin v těle organismu. Je otázkou, které další aktivátory a RNA mechanismy budou tuto část zduplikovaného genu „obsluhovat“ ve správný čas, ve správném pořadí a na správném místě. Navíc, jak víme, že takový zduplikovaný gen zůstane aktivován? Proč by si přírodní výběr pracně hromadil a kumuloval nepotřebný materiál??

   V drtivé většině případů nekumuloval/nehromadil (proč taky?), zduplikovaný gen zůstává inaktivován a rychle mizí z populace. Představa toho, že by v každé sousledné generaci došlo k jeho fixaci, patří opět do říše neudržitelných mýtů.

    3. Ve zduplikované sekvenci došlo ke zlepšující změně z jedné         biologické funkce (fitness) organismu do druhé.

   „Pozitivní mutace“ je silně matoucí pojem, neboť více, než 99,9 % všech mutací jsou negativní, ztrátové, zbylé desetiny procenta možno označit za latentní/neutrální či vzácně: „pozitivní*. Jak rychle se v neodarwinistickém konceptu zduplikuje jeden gen? Podle odhadů asi 100 genů za 1 milion let. [25] To je příliš velký časový prostor pro působení mutagenních procesů (ionizující záření, chemomutageny, transposony aj.), mající za následek ztrátu biologické funkce, popř. deaktivaci genu. Když se podíváme [26] na analýzu dat sekvenování současných genů, ať již u rostlin nebo jen u některých živočichů, vyvstávají zde obrovské disproporce: Např. Prutovka nahá (Psilotum nudum) je mnohem daleko jednodušší, než rostliny z rodu huseníček (Arabidopsis thaliana) a přesto má až 3 000x větší genom. Bahník (aethiopicus), ryba žijící v deltách řek má cca 40x větší genom ve srovnání s člověkem, a přesto nikdo netvrdí, že by v evolučním vývojovém stromu zaujímala vyšší postavení.

   Bakterie z kmene Firmicutec (Epulopiscium fishelsoni) obsahuje 85 000 zduplikovaných genů. [27] Tyto geny nenesou žádné stopy, ba ani náznaky, že by se v průběhu evoluce, kdy chystaly podstoupit jakékoliv komplexnější změny. Čelíme tak nebývalému chaosu, který je velmi nedostatečně vysvětlován standardními evolučními předpoklady a procesy.

______________________________________________

* Pozn.: „pozitivní“ – dočasně nebo na úkor jiných korektně optimalizovaných funkcí. V obou kategoriích vznikají znaky degenerativního charakteru se sníženou bohatostí genofondu.

   Závěrem si proto položme klíčovou otázku:

   Jak si zastánci evoluční teorie na jednoduché analogii [17] 55 stránkového textu představují nárůst smysluplných informačních dat, do např. 250 svazků? Jak dochází k postupnému, kumulativnímu, kvantitativnímu i kvalitativnímu nárůstu bohatosti genofondu prvotních organismů do taxonomicky vyšších kategorií živočichů a rostlin? Jaké jsou vědecky prokazatelné důkazy a experimentálně ověřitelná fakta tohoto základního kamenu evoluce?

      …a je tento „kámen“ evoluce vůbec podložen?

[Použitá literatura a odkazy]

[1] - HART-DAVIS, Adam a kol.: „Věda“, 1. Vydání. Praha: Euromedia Group, k. s. – Knižní klub, 2011, s. 348, ISBN 978-80-242-3078-8

[2] - Nobel prize - Lotta Fredholm: „The Discovery of the Molecular Structure of DNA – The Double Helix“: http://www.nobelprize.org/educational/medicine/dna_double_helix/readmore...

[3] - ILIC, B. - YANG, Y. and col.: Nano Letters: „Enumeration of DNA Molecules Bound to a Nanomechanical Oscillator“, Vol. 5, n. 5, 2005, p. 925

[4] - ALBERTS, B. – JOHNSON, A. and col.: „Molecular Biology of the Cell.“ 4th edition. New York: Garland Science; 2002: http://www.ncbi.nlm.nih.gov/books/NBK26834/

[5] - ULMSCHNEIDER, P.: „Inteligent Life in the Universe“ 2nd edition, Springer: 2006, p. 125: http://www.e-reading.biz/bookreader.php/135157/Intelligent_Life_in_the_U...

[6] - MARTIN , W. F. – MULLER, M.: „Origin of Mitochondria and Hydrogenosomes“, Springer-Verlag: 2007, p. 21, ISBN-10 3-540-38501-1

[7] - ČERNÝ, M.: „Lékařská genetika“, Státní zdravotnické nakladatelství, Vydání první Praha 1967, s. 28

[8] – SEILER, S.: „Scientists discover double meaning in genetic code“, UW Health Sciences & UW Medicine,“ Dostupné online, Dec 12, 2013: http://www.washington.edu/news/2013/12/12/scientists-discover-double-mea...

[9] – ASM Microbel Library: MELLIES, "J.: Bacterial Flagella Stain Protocol" – 2008: http://www.microbelibrary.org/component/resource/laboratory-test/3153-ba...

[10] – Creation-magazine: STEVEN, D.: "The Amazing Motorized Germ" – 2004: http://www.answersingenesis.org/articles/cm/v27/n1/germ

[11] – Media in Corporated: "What Darwin Didn´t know": http://www.mediaincorporated.com/html/sg_darwin.html

[12] – GITT, Werner and K.-H.Vanheiden, „If Animals Could Talk“; CLV 1994,
New Jersey, p. 86, ISBN 0-87213-225-0.

[13] – MARATHE, A.; CONDON, A. E.; CORN, R. M.: „On combinatorial DNA word design.“ J Comput. Biol. 2001, roč. 8, čís. 3, 201-19, dostupné online: http://www.ncbi.nlm.nih.gov/pubmed/11535173

Překlad: https://cs.wikipedia.org/wiki/DNA#cite_note-52

[14] – BALL, P. – Nature: „Smallest genome clocks in at 182 genes“, 2006: http://www.nature.com/news/2006/061009/full/news061009-10.html

[15] – MASTIN, L. – The Physis of the Universe: „The Universe by Numbers“: http://www.physicsoftheuniverse.com/numbers.html

[16] – KIMBALL, J. W. – Biology Pages: „Genome Sizes“, 2013: http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/G/GenomeSizes.html

[17] - RIDLEY, M.: „Genom – Životopis lidského druhu v třiadvaceti kapitolách“, 1. vyd., přeložil Ivo Muller, Portál, Praha 2001, s. 12

[18] – JESO, P.: „Štruktúra bielkovín“: http://www.bio-che.szm.com/bielkoviny2.htm

[19] – VOTOČEK, L. - Cep: „Petr Hájek: Já z opice nepocházím“, 2009: http://cepin.cz/en/diskuse.php?ID=896&typ=CL&vlozit=0

[20] – GITT, W.: „In the beginning was information.“ 2nd English edition: CLV, 2000. 256 p. ISBN 3-89397-255-2.

[21] – Pozn.: Tyto návrhy byly sestaveny na základě podnětu (evolucionisty), Mgr. Michala Hanka.

[22] – TAMAMES, J. at. all.: „The frontier between cell and organelle: genome analysis of Candidatus Carsonella ruddii", publikováno online, 2007, Oct: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2175510/

[23] - MicrobeWiki, dostupné online, 3 Sept. 2010: https://microbewiki.kenyon.edu/index.php/Candidatus_Carsonella_ruddii
BANASZEK, T.: „Carsonella ruddii“, Missouri University of Science and Technology: http://web.mst.edu/~microbio/bio221_2007/C_ruddii.htm

[24] – Viz: ČERNÝ, M.: „Lékařská Genetika“, s. 59.

[25] – LYNCH, M. a CONERY, J. S.: „The Evolutionary Fate and Consequences of Duplicate Genes.“ Science (2000), 290: 1151-1155. Dostupné online: http://www.ncbi.nlm.nih.gov/pubmed/11073452

[26] – „Genome Sizes“, Dostupné online - 3 Apr 2016: http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/G/GenomeSizes.html

[27] – Microbial Classification: „A brief introduction to the diversity of the microbial world.“ Dostupné online (4 apr., 2016): http://microbialclassification.blogspot.cz/p/bacteria.html

PřílohaVelikost
939-20.4.2016-informace-dna.doc2.72 MB
Průměr: 3.7 (3 votes)
Obrázek uživatele Alexander

Re: George

Fotone, prestan se vykrucovat. Ty sam jsi tehdy v X prispevcich uznal, ze ten rozdil tam je, akorat jsi ho oznacoval za nedulezity a arumentoval, ze od analogie neocekavas 100% apod.
Je to jednoduche, bud tu mutaci na vetach demonstrovat zvladnes ci nikoliv.

Príklad ktorý som ti dal bola veta. Jednalo sa o príklad frameshift mutácie na tej vete, pričom výsledkom bola opäť zmysluplná veta. =Bolo vyvrátené tvoje tvrdenie, že to nejde.

Ty "jednoslovne vety", kterymi se tu ted ohanis, jsi ignoroval prave kvuli tomu, co pises. Tzn.

Cituj, kde som ignoroval jednoslovné vety.

Cili tehdy jsi odmital, abych ti to, co jsi pozadoval, demonstroval na slovech ci "jednoslovnych vetach", protoze ti bylo jasne, ze by to nemusel byt problem. Takze jsi porad mlel o Pythagorove vete apod. A ted najednou sam vytahujes jednoslovne vety.

Príklad jednoslovnej vety sa dá použiť na vyvrátenie tvojho tvrdenia, že na vetách nelze demonstroval frameshift mutácie s významom na výstupe. (Akurát sa také vety nedajú porovnať s génmi vzhľadom na ich dĺžku. To je celé.)
Po druhé:
Ten gén, na ktorý si mi dal odkaz bol vlastne zničený tou frameshift mutáciou. Nový význam dostal len jeden krátky úsek z pôvodnej dĺžky génu, a to význam len veľmi sporadický, v porovnaní s pôvodnou funkciou na pôvodnej dĺžke. Čiže ak by sme to mali preniesť do viet: vezmeme viacslovnú vetu a aplikujeme na ňu frameshift mutáciu. Veta sa zničí, ale uprostred vznikne jedno nové slovo, napr.: "choď". Čiže pôvodne dlhá veta dostane po frameshift mutácii nový význam. (=výsledný efekt je rovnaký, ako tvoj príklad.) -Chceš takú vetu?

Pak to neni "nesmyslna mutace". Nemusi se ti to libit, ale to je asi tak vsechno, co s tim muzes delat.

Náhodne zaradená aminokyselina do génu je niečo ako náhodne zaradené písmeno do vety. Pôvodný význam sa kazí, pôvodná funkcia dostáva poruchy. Nakoniec sa úplne znefunkční. (čím viac takých zmien aplikujeme.)

Co je tezke k pochopeni na tom, ze neni, protoze jde o specificky pojem, ktery ma v ramci meho oboru zcela jasnou definici?

Tá definícia je špatná. Je mimo významu slova "neutrálny":
Neutrálny = "nemajúci určité vlastnosti, neurčitý, nevyhranený;"
Neutrálnosť = "neprejavovanie určitých vlastností, nevyhranenosť;"

Proc? Tongue Protoze na PC to jinak nejde?

Nie len na PC. Všade: "Slovo program označuje plán, podle kterého se řídí průběh určité události nebo činnosti. Popisuje jednotlivé části či podmínky, ze kterých se celek skládá"

Samozrejme, ze je. Jde o uhel pohledu z jakeho je "neutralni".

Nie. Ide o význam pojmu "neutrálny". Uhol pohľadu s tým nemá nič.

Aha a co me je do toho? Ty se chces se mnou bavit o ET/ genetice, takze bud to prijmes a nebo se bav o cem chces, ale pak se uz se proste nebavis o ET/genetice a tve zavery v danem smeru maji nulovou vypovidaci hodnotu.

Môžeš sa so mnou baviť o exaktných veciach platných univerzálne, nie o veciach podliehajúcich subjektivizmu.
....Určité definície podliehajú značnému subjektivizmu. Hlavne tie, ktoré neplatia objektívne. Napríklad definujeme si meter, sekundu, kilogram. Príroda nepozná nič také, ako meter alebo sekundu. Za to však pozná napr ludolfovo číslo, zlatý rez alebo planckovu konstantu (ktoré si môžeš vyjadriť v ľubovoľných jednotkách - napr. SI. Na ne samotné to však nemá vplyv.)

Tvoje "logika" nikoho nezajima. Co znamena "neutralni mutace" je jasne dano, stejne jako je jasne dano (mnohem jasneji, nez co je "kupni sila" mimochodem) "nesmyslna mutace".

To je mi 5. Wink

Kazdy obor pouziva vlastni terminologii. Pokud se ti to nelibi, nikdo te nenuti o nem zkouset debatovat a pak mlit neco o logice.

Terminológia sa však nepoužíva ako dôkaz.

= Tvrdenie, ktoré nedáva žiadnu logiku.
Neni vyzadovano, aby Fotonovi davalo logiku.

Nikoho som neprosil, aby to odo mňa vyžadoval.

Hm, jak dlouhy by mel byt mutovany gen, abys mi nasledne nenahodil ten "protiargument":
Výnimkou sú krátke funkčné usporiadania, pri ktorých značné percento variácii sa dá vystriedať rozumným počtom pokusov).
- co je "kratke funkcni usporadani"?

Bežná dĺžka. Stačí medzi 1-2 kb. (Rozdiel medzi oboma aspoň 300 b.)

Re: Krom toho Georgi -

Jinym druhem to ale nebude jen proto, ze reknes, ze to je jiny druh.

Ja nic rikat nemusim Vlasto, ostatne pokud vim tak za duchovniho otce taxonomie je povazovan kreacionista Linne. Ten, kdo si musi nalhavat, ze o novy druh nejde, jsi ty.

No, moc se Ti to ale nedari. Mutace jaksi nahodne nejsou.

Mutace jsou nahodne presne v tom smyslu, jaky jsem opakovane uvadel nebo jako je popsan v tom odstavci, ktery jsem citoval z jedne knizky. To, ze mi do toho porad cpete neco jineho, neni muj problem.

Obrázek uživatele JHK

Re: Krom toho Georgi -

----Ja nikde netvrdil, ze tato definice je spatna, v bezne reci. Ale ja tu neresim beznou rec, resim v jakem smyslu jsou nahodne mutace v ET.----

No, moc se Ti to ale nedari. Mutace jaksi nahodne nejsou. To ovsem clovek bez rozumu jen tezko nejak vstreba. Nejdriv je treba dostat ten rozum a pak se tu snazit neco dokazovat Georgi. V.S.

Obrázek uživatele JHK

Re: Krom toho Georgi -

---K tvemu predchozimu prispevku, nove druhy zivocichu vznikaji z jinych druhu zivocichu jako na bezicim pasu - jediny, kdo to popira, jsou fanatici tveho typu.----

Klidne si popis dve zizaly jako jiny druh, to je Tvoje vec. Jinym druhem to ale nebude jen proto, ze reknes, ze to je jiny druh. A fanatikem budu radeji nez byt slepy a hluchy a rikat ze vsechno vidim lepsi nez ten, ktery takto postizen neni. V.S.

Re: George

Príklad ktorý som ti dal bola veta. Bolo vyvrátené tvoje tvrdenie, že to nejde? Bolo.

Fotone, prestan se vykrucovat. Ty sam jsi tehdy v X prispevcich uznal, ze ten rozdil tam je, akorat jsi ho oznacoval za nedulezity a arumentoval, ze od analogie neocekavas 100% apod.

Ty "jednoslovne vety", kterymi se tu ted ohanis, jsi ignoroval prave kvuli tomu, co pises. Tzn.

O slovách platí to isté, ako o vetách. Slová sú akurát kratšie významové celky. Preto je dosiahnuteľné náhodnými mutáciami nejaký ten význam časom dostať v rozumnom počte pokusov.

Cili tehdy jsi odmital, abych ti to, co jsi pozadoval, demonstroval na slovech ci "jednoslovnych vetach", protoze ti bylo jasne, ze by to nemusel byt problem. Takze jsi porad mlel o Pythagorove vete apod. A ted najednou sam vytahujes jednoslovne vety.

Nie každá nezmyselná mutácia vyprodukuje terminačný kodón.

Pak to neni "nesmyslna mutace". Nemusi se ti to libit, ale to je asi tak vsechno, co s tim muzes delat.

Neplač a venuj sa téme. Odpovedaj relevantne. Necestuj z Prahy do Brna cez Bratislavu.

Ja se venuji tematu a odpovidam relevantne. To ty to nedelas. Delas totez, jako kdybychom se bavili o kupni sile a jejim mereni a ty jsi mi porad dokola psal:

Síla se měří zpravidla pomocí jejich deformačních účinků (měření síly se převádí na měření výchylky - délky nebo úhlu) nebo vyvolanými změnami elektromagnetických vlastností prostředí (měření síly se převádí na měření el. proudu nebo el. napětí).

Nezmyselná mutácia je taká mutácia, výsledkom ktorej nie je žiaden zmysel, funkcia, vlastnosť. Čo je na tom ťažké k pochopeniu?

Co je tezke k pochopeni na tom, ze neni, protoze jde o specificky pojem, ktery ma v ramci meho oboru zcela jasnou definici?

Opakujem oznam: Ku vzniku programu je potrebný programátor.

Proc? Tongue Protoze na PC to jinak nejde?

Ak mutácia spôsobí "zjistitelnou zmenu ve fenotypu", už není neutrální.

Samozrejme, ze je. Jde o uhel pohledu z jakeho je "neutralni".

Pár ľudí sa dohodlo, že takto a takto niečo definujú. So mnou sa nikto o tom nedohodol, takže nemusím to prijať.

Aha a co me je do toho? Ty se chces se mnou bavit o ET/ genetice, takze bud to prijmes a nebo se bav o cem chces, ale pak se uz se proste nebavis o ET/genetice a tve zavery v danem smeru maji nulovou vypovidaci hodnotu.

Mutácia, prejav mutácie, a selekcia, sú 3 rôzne veci. Ak sa mutácia prejaví viac alebo menej vo fenotype, už ju nemôžeme logicky nazývať "neutrální".

Tvoje "logika" nikoho nezajima. Co znamena "neutralni mutace" je jasne dano, stejne jako je jasne dano (mnohem jasneji, nez co je "kupni sila" mimochodem) "nesmyslna mutace".

Kazdy obor pouziva vlastni terminologii. Pokud se ti to nelibi, nikdo te nenuti o nem zkouset debatovat a pak mlit neco o logice.

= Tvrdenie, ktoré nedáva žiadnu logiku.

Neni vyzadovano, aby Fotonovi davalo logiku.

Jednotky, najviac desiatky.

Hm, jak dlouhy by mel byt mutovany gen, abys mi nasledne nenahodil ten "protiargument":

Výnimkou sú krátke funkčné usporiadania, pri ktorých značné percento variácii sa dá vystriedať rozumným počtom pokusov).

- co je "kratke funkcni usporadani"?

Obrázek uživatele Alexander

Re: George

To som ja, fotón. Teraz budem používať tento nick.

Opakuji puvodni oznameni - demonstraci na slovech jsi odmital TY SAM, protoze se ti tenkrat nehodila do kramu. A trval sis na svem. Takze mi ted necpi zadne "jednoslovne vety" a demonstruj to na tom samem, co jsi tenkrat zarputile pozadoval (nejen) ode me - to byly rozhodne znacne delsi vety (nebo jsi to taky "zapomnel")? Napriklad ta Pythagorova, ze.

1. Novinka: existujú aj vety s jedným slovom.
2. Už ti bolo oznámené, prečo do zložitejších viet zatiaľ nejdem.

Na tripletech jsem to demonstroval ja, po tobe jsem to chtel na vetach. Hele nebudu ti "prehravat" cely prubeh te diskuse, mam uplne jine veci na praci a podle me moc dobre vis o co ti tehdy slo a proc nejake jednoduche jednoslovne - dvouslovne vety jsi tehdy neuvedl, ac jsi byl o to opakovane zadan. Ted najednou tvrdis, jak strasne je to jednoduche, no tak jsi to mohl vytahnout uz tenkrat. Hlavne se me nesnaz presvedcit, ze te napadlo az ted.

Príklad ktorý som ti dal bola veta. Bolo vyvrátené tvoje tvrdenie, že to nejde? Bolo.

Jak ktere, rekl bych. Smile

Máš dojem, že slovo "obyčajne" znamená "vždy"?

Jinak je to tvuj problem, viz tento muj prispevek.

Zas príspevok nenadpísaný "fotón". (Teraz môžeš nadpisovať už aj "Alexander").

Ach jo. Pokud dojde k nesmyslne (nonsence) mutaci, tak vznikne terminacni kodon. Jakou aminokyselinu terminacni kodon koduje, aby se mohla zaradit?

Nie každá nezmyselná mutácia vyprodukuje terminačný kodón.

Problem tady tech debat spociva v tom, ze ty si vymyslis vlastni definice nebo urcite pojmy pouzivas v jinych vyznamech, nez jake maji v ET. Ted mi totez delas s tou nahodou.

Neplač a venuj sa téme. Odpovedaj relevantne. Necestuj z Prahy do Brna cez Bratislavu.

Pokud odmitas akceptovat i to, ze stejna slova mohou nabyvat v ruznych oborech ruznych vyznamu, tak fakt nema smysl s tebou neco resit, protoze se neda k nicemu dospet. Budes se akorat dohadovat o veci typu "smyslna mutace", ktere jsou ovsem v ramci meho oboru jasne vymazene - mutace ma smysl tehdy... vymyslet si vlastni definice atd.

Nezmyselná mutácia je taká mutácia, výsledkom ktorej nie je žiaden zmysel, funkcia, vlastnosť. Čo je na tom ťažké k pochopeniu?

Aha a proc se ti tedy tenkrat demonstrace na slovech ani trosku nezamlouvala? Nebylo to nahodou prave proto, ze na nich bych mohl spis predvest to, co jsi pozadoval (ovsem s Pythagorovou vetou) a tak mohl "nabourat" tva tvrzeni o ET?

O slovách platí to isté, ako o vetách. Slová sú akurát kratšie významové celky. Preto je dosiahnuteľné náhodnými mutáciami nejaký ten význam časom dostať v rozumnom počte pokusov. Gény sú ale dlhšie, preto sú svojou dĺžkou porovnateľné skôr s vetami. (Preto ten dôraz na vety.)

Ne, neni.

I keď to nie je úplne to isté, dá sa to k tomu dobre prirovnať. (Ten príklad so zosilovačom by bol lepší. Škoda, že si ho odignoroval.)

To je jen preklad nazvu toho clanku, ktery se ti sveho casu strasne nezamlouval (a "prekvapive" ses opet branil jinak, nez ze vlastne netvrdis to "pocitacovy...").

Opakujem oznam: Ku vzniku programu je potrebný programátor. (Je úplne jedno, či sa jedná o mechanický Pascaline, elekttronické PC alebo DNA.)

Nebyla. Tvrdil jsi, ze neutralni mutace nezpusobi zadnou zjistitelnou zmenu ve fenotypu a to je proste blabol, at to okecavas jak chces.

Ak mutácia spôsobí "zjistitelnou zmenu ve fenotypu", už není neutrální.

Ani to, ze jsi to s nejvetsi pravdepodobnosti zkopiroval z prekladu jednoho clanku od Maddoxe (takze mozna jdejen o spatny preklad), na tom nic nezmeni.

Tvrdenia a definície nie sú dôkazy. Pár ľudí sa dohodlo, že takto a takto niečo definujú. So mnou sa nikto o tom nedohodol, takže nemusím to prijať. Wink

Neutralni mutace projev ve fenotypu mit muzou, pouze neni selektovan. Z toho vsem neplyne, ze onen projev neni "zjistitelny" (jinak bychom to ani nevedeli, ze). A jestli jsi to myslel tak, jak me zrovna ted napadlo (ale nebudu to psat), tak jsi to mel rozepsat.

Mutácia, prejav mutácie, a selekcia, sú 3 rôzne veci. Ak sa mutácia prejaví viac alebo menej vo fenotype, už ju nemôžeme logicky nazývať "neutrální". Veď mysli aj sám. Nenechávaj za seba myslieť knihy. (Lebo zostaneš vždy iba otrokom.) Wink

Precti si o tom neco treba tady v tom PDF od Smykala, je to hned na zacatku.

neutralní mutace mající malý nebo žádný fenotypový efekt
Nebo mutace, které neovlivňují Darwinistickou zdatnost jedince

= Tvrdenie, ktoré nedáva žiadnu logiku.

Po jakem poctu?

Jednotky, najviac desiatky.

Zkus konkretni pocet.

100?

Tvvrdis, ze existuje jen jedna definice nahody?

Žiadna definícia náhody nespraví z nej nenáhodnú veličinu.

Re: Krom toho Georgi -

Vlastiku, u definice nahody, kterou se tu ohanite (z Wiki) je uvedeno:

Náhoda v běžné řeči označuje jevy, jejichž výskyt neumíme vysvětlit.

Ja nikde netvrdil, ze tato definice je spatna, v bezne reci. Ale ja tu neresim beznou rec, resim v jakem smyslu jsou nahodne mutace v ET.

Náhodnost v darwinovském smyslu neznamená, že by každá mutace musela být prostě jenom omyl, že existují i mutace indukované prostředím, a koneckonců v buňce funguje celá složitá bílkovinná mašinerie, která mutace dělá a hlavně opravuje (protože většina mutací svému nositeli škodí). To pořád není žádný lamarckismus – jsou-li ovšem mutace opravdu náhodné, pokud jde o jejich (budoucí) adaptivní význam.

K tvemu predchozimu prispevku, nove druhy zivocichu vznikaji z jinych druhu zivocichu jako na bezicim pasu - jediny, kdo to popira, jsou fanatici tveho typu.

Krom toho Georgi -

Tvvrdis, ze existuje jen jedna definice nahody?

- máš snad za to, že ta definice, kterou tu Foton uváděl - je špatná? V.S.

Biologická evoluce určitě probíhá -

Nejak premyslim o tom, co se mi tim dlouhosahlym prispevkem vlastne snazis sdelit? Jestli to, ze za DNA mohla stat nejaka inteligence, tak jiste mohla, ale to proste nemeni nic na tom, ze biologicka evoluce probiha.

- ovšem ne ve smyslu - tvorby nových druhů živočichů z jiných druhů živočichů a už vůbec ne proměnou buňky v člověka během miliard let. To, že se živočichové mění v rámci svého stvořeného druhu - je jistě něco, co lze dokázat a proti čemu nemá nikdo nic. V.S.

Re: George

Čiže také vety existujú a tvoje tvrdenie, že to "nejak nejde" neplatí.

Opakuji puvodni oznameni - demonstraci na slovech jsi odmital TY SAM, protoze se ti tenkrat nehodila do kramu. A trval sis na svem. Takze mi ted necpi zadne "jednoslovne vety" a demonstruj to na tom samem, co jsi tenkrat zarputile pozadoval (nejen) ode me - to byly rozhodne znacne delsi vety (nebo jsi to taky "zapomnel")? Napriklad ta Pythagorova, ze.

Lenže ja som to demonštroval na tripletoch, a o to išlo.

Na tripletech jsem to demonstroval ja, po tobe jsem to chtel na vetach. Hele nebudu ti "prehravat" cely prubeh te diskuse, mam uplne jine veci na praci a podle me moc dobre vis o co ti tehdy slo a proc nejake jednoduche jednoslovne - dvouslovne vety jsi tehdy neuvedl, ac jsi byl o to opakovane zadan. Ted najednou tvrdis, jak strasne je to jednoduche, no tak jsi to mohl vytahnout uz tenkrat. Hlavne se me nesnaz presvedcit, ze te napadlo az ted. Tongue

V rozbehnutej diskusii obyčajne príspevky nenadpísané mojim nickom preskakujem a nečítam.

Jak ktere, rekl bych. Smile
Jinak je to tvuj problem, viz tento muj prispevek.

Nepravda. Zaradiť sa môže aj bez zmyslu. (Zrejme máš asi guláš v tom, čo je adresát.)

Ach jo. Pokud dojde k nesmyslne (nonsence) mutaci, tak vznikne terminacni kodon. Jakou aminokyselinu terminacni kodon koduje, aby se mohla zaradit?

Problem tady tech debat spociva v tom, ze ty si vymyslis vlastni definice nebo urcite pojmy pouzivas v jinych vyznamech, nez jake maji v ET. Ted mi totez delas s tou nahodou.

Pokud odmitas akceptovat i to, ze stejna slova mohou nabyvat v ruznych oborech ruznych vyznamu, tak fakt nema smysl s tebou neco resit, protoze se neda k nicemu dospet. Budes se akorat dohadovat o veci typu "smyslna mutace", ktere jsou ovsem v ramci meho oboru jasne vymazene - mutace ma smysl tehdy... vymyslet si vlastni definice atd.

Delas to permanente, viz tento prispevek a spousta dalsich.

Samozrejme. Bez správneho usporiadania znakov nedostaneš zmysluplné slovo.

Aha a proc se ti tedy tenkrat demonstrace na slovech ani trosku nezamlouvala? Nebylo to nahodou prave proto, ze na nich bych mohl spis predvest to, co jsi pozadoval (ovsem s Pythagorovou vetou) a tak mohl "nabourat" tva tvrzeni o ET?

To je ako vziať minulé podané čísla športky, náhodne zmeniť jednu pozíciu na iné a znovu podať (mutácia A), a nabudúce postup zopakovať (mutácia B).

Ne, neni.

Mohol by si mi citovať, kde som tvrdil, že je počítačový?

To je jen preklad nazvu toho clanku, ktery se ti sveho casu strasne nezamlouval (a "prekvapive" ses opet branil jinak, nez ze vlastne netvrdis to "pocitacovy...").

Byla.

Nebyla. Tvrdil jsi, ze neutralni mutace nezpusobi zadnou zjistitelnou zmenu ve fenotypu a to je proste blabol, at to okecavas jak chces.

Ani to, ze jsi to s nejvetsi pravdepodobnosti zkopiroval z prekladu jednoho clanku od Maddoxe (takze mozna jdejen o spatny preklad), na tom nic nezmeni. Tongue Neutralni mutace projev ve fenotypu mit muzou, pouze neni selektovan. Z toho vsem neplyne, ze onen projev neni "zjistitelny" (jinak bychom to ani nevedeli, ze). A jestli jsi to myslel tak, jak me zrovna ted napadlo (ale nebudu to psat), tak jsi to mel rozepsat.

Precti si o tom neco treba tady v tom PDF od Smykala, je to hned na zacatku.

Po určitom počte takýchto zmien dôjde skôr či neskôr k znefunkčneniu.

Po jakem poctu?

Rozdiel je v počte pozícii AK, ktorými sa od seba líšia 2 bielkoviny.

Zkus konkretni pocet.

Jav môžeme považovať za náhodný len z dvoch dôvodov.

Tvvrdis, ze existuje jen jedna definice nahody?

Customize This